Uromodulin gene polymorphisms in patients with cast nephropathy in multiple myeloma

Abstract

Aim. To investigate the nature of mutations in exons 4 and 5 of the uromodulin (UM) gene, including in the area encoding the domain of 8 cysteines (D8C), in patients with multiple myeloma (MM) with the secretion of monoclonal light chains (LC) in cast nephropathy (CN) and without kidney injury. Subjects and methods. The investigation enrolled 24 patients in MM remission, who were observed to have monoclonal LC secretion at onset. Group 1 included 14 patients with CN; Group 2 consisted of 10 patients with normal renal function (a comparison group). The compared groups did not differ in the number of serum and urinary monoclonal LCs. Genomic DNA was extracted from the peripheral blood samples of patients. The nucleotide sequence of exons 4 and 5 of the UM gene was determined by the Sanger method. Results. No differences were found in the frequency of polymorphisms depending on the severity of kidney injury. The missense mutation p.142R>R/Q in the UM gene, which had not been previously described, was discovered. Conclusion. The patients with MM were not found to have statistically significant differences in the frequency and nature of polymorphisms of exons 4 and 5 in the UM gene, including in the area encoding D8C, in CN without kidney injury.

Full Text

КН — каст-нефропатия ЛЦ — легкие цепи ММ — множественная миелома ПН — почечная недостаточность УМ — уромодулин ХПН — хроническая почечная недостаточность D8C — домен 8 цистеинов Каст-нефропатия (КН) — наиболее частая причина почечной недостаточности (ПН) при множественной миеломе (ММ). В структуре поражений почек, обусловленных парапротеином, КН составляет 41— 65% [1—3]. Основным звеном патогенеза КН является образование белковых цилиндров в дистальном отделе почечных канальцев вследствие взаимодействия моноклональных легких цепей (ЛЦ) с уромодулином — УМ (белком Тамма—Хорсфалла). Установлено, что ЛЦ связываются с УМ посредством фрагмента СDR3 [4—6]. Обструкция просвета почечных канальцев белковыми цилиндрами приводит в последующем к тубулоинтерстициальному воспалению и острому повреждению почек. Развитие КН сопряжено с высокой секрецией белка Бенс-Джонса, поэтому содержание моноклональных свободных ЛЦ в сыворотке более 1500 мг/л служит одним из диагностических критериев этого варианта поражения почек [7]. Вместе с тем хорошо известно, что не у всех больных ММ с секрецией ЛЦ развивается КН. В частности, в исследовании M. Drayson и соавт. [8] из 310 больных миеломой Бенс-Джонса только у 42% больных выявлена ПН. В настоящее время нет однозначного ответа на вопрос, почему не у всех больных ММ с секрецией моноклональных ЛЦ развивается КН. Наибольшее распространение получила концепция о нефротоксичных свойствах ЛЦ у больных КН. В 1991 г. опубликована работа, в которой доказывалась возможность развития КН у подопытных животных при введении им ЛЦ, полученных от больных ММ с П.Н. При этом КН не формировалась, если белок Бенс-Джонса выделен от пациентов ММ без поражения почек [9]. Это исследование послужило толчком к изучению различий физико-химических свойств ЛЦ, которые могли бы объяснить их нефротоксичность [10—13]. Обнаружено множество структурных аномалий ЛЦ в виде изменения аминокислотной последовательности вариабельного региона, длины молекул, нарушения гликозилирования, повышения полимеризации и гидрофобности, что способствует их агрегации в тканях [12, 14—20]. Эти данные получили признание в качестве рабочей теории органных повреждений при AL-амилоидозе и болезни депозитов Л.Ц. Однако попытка выявить различия в строении вариабельного региона ЛЦ и отдельно фрагмента CDR3 у больных ММ с КН и без поражения почек оказалась неудачной. На основании полученных данных сделан вывод, что вероятность развития КН и тяжесть поражения почек невозможно прогнозировать на основании анализа нуклеотидной последовательности вариабельного региона ЛЦ иммуноглобулинов [21]. В то же время показано, что ЛЦ обладают различной способностью связываться с У.М. Аминокислотная последовательность фрагмента CDR3 и вторичная структура ЛЦ являются определяющими в силе этого взаимодействия. Удалось даже синтезировать циклический пептид, который, связываясь с УМ, предотвращал развитие КН у экспериментальных животных [6]. В настоящее время концепция о различной способности ЛЦ связываться с УМ является ведущей в понимании патогенеза К.Н. Вместе с тем это единственное исследование, которое пока не подтверждено в клинических работах. УМ (белок Тамма—Хорсфалла) секретируется эпителиальными клетками восходящего отдела петли Генле в количестве 20—100 мг/сут [22]. Синтез У.М. кодируется геном, располагающимся на хромосоме 16p12.3. Ген У.М. состоит из 11 экзонов. В 4-м экзоне находится домен 8 цистеинов (D8C), биологическая функция которого неясна. Однако посредством именно этого участка УМ взаимодействует с фрагментом CDR3 ЛЦ при КН. В настоящее время выявлено 113 мутаций в гене У.М. Большинство мутаций обнаружено в 4-м (более 80%) и 5-м (более 11%) экзонах. В D8C известно 35 мутаций [23—28]. Благодаря расшифровке генома человека в последние годы появились данные об ассоциированных с УМ болезнях почек и участии УМ в развитии хронической почечной недостаточности (ХПН). Предполагают, что мутантный УМ задерживается в эндоплазматической сети клеток, что приводит к их повреждению. С внутриклеточной аккумуляцией УМ связывают нарушение концентрационной способности почек, повышение реабсорбции натрия и мочевой кислоты в проксимальном отделе канальцев, а также развитие интерстициального воспаления и фиброза [29]. Фенотипически мутации гена УМ проявляются гиперурикемией, подагрой, образованием кист в почках, хроническим тубулоинтерстициальным нефритом с ранним развитием терминальной стадии ХПН [30]. Несмотря на непосредственное участие УМ в формировании КН, отсутствуют данные о возможных изменениях его структуры, особенно в D8C, при М.М. Нуждается в изучении вопрос о наличии мутаций гена УМ и их значении в развитии КН. Цель исследования: изучить характер мутаций в 4-м и 5-м экзонах гена УМ у больных ММ с секреций моноклональных ЛЦ и сравнить их частоту при КН и без поражения почек. Материалы и методы В исследование включили 24 больных ММ, находящихся в ремиссии. В дебюте заболевания у 5 (21%) больных выявлена секреция PIgG, у 2 (8%) — PIgА, у 1 (4%) — PIgD, у 1 (4%) — PIgM, у 15 (63%) пациентов диагностирована миелома Бенс-Джонса. У всех больных в моче определялся белок Бенс-Джонса. У 17 (71%) пациентов отмечалась секреция ЛЦ κ-типа, у 7 (29%) — λ-типа. Пациентов разделили на 2 группы. В 1-ю группу вошли 14 больных ММ с диализозависимой ПН, обусловленной К.Н. Диагноз К.Н. устанавливали на основании критериев IMWG [4], у 7 пациентов характер нефропатии подтвержден гистологически. Во 2-ю группу (группу сравнения) включили 10 больных ММ, у которых в дебюте заболевания при наличии моноклональной секреции ЛЦ ПН отсутствовала. Критерием включения пациентов в группу сравнения служило наличие одного из следующих критериев: 1) наличие белка Бенс-Джонса в сыворотке по результатам иммуноэлектрофореза и денситометрии или содержание моноклональных свободных ЛЦ в сыворотке более 1500 мг/л; 2) наличие белка Бенс-Джонса в моче более 1 г/сут. Для исследования мутаций в гене УМ использована геномная ДНК, выделенная из образцов периферической крови пациентов. Амплификацию 4-го и 5-го экзонов гена УМ проводили с помощью праймеров Umod45_for 5’-CTGAAGCTGGGCTTTTCTGT-3’ и Umod45_rev 5’-CTCACAGGGGAGGAATGTGT-3’ с использованием реакционной смеси PCR MasterMix 2X («Promega», США) при следующих условиях: первоначальная денатурация 5 мин; 35 циклов 94 °C — 30 с, 60 °C — 30 с, 72 °C — 90 с; итоговая элонгация 72 °C — 10 мин. Определение нуклеотидной последовательности проводили методом Сэнгера на автоматическом секвенаторе ABI3130 («Termofisher Scientific», Foster City, США) с использованием набора Big Dye Terminator V3.1 Cycle Sequencing Kit («Termofisher Scientific», Foster City, США) и указанных праймеров и двух дополнительных: Umod45_seq1 5’GCCCTGGCCACATGTGTCAATGTGG 3’ и Umod45_seq4 5’GGGTCACAGGGACAGACAGACAAT 3’. Результаты Статистически значимых различий по количеству секретируемых моноклональных ЛЦ в сыворотке и моче не получено, что позволило считать сравниваемые группы сопоставимыми (табл. 1). Результаты исследования мутаций 4-го и 5-го экзонов гена УМ представлены в табл. 2. В результате изучения 4-го и 5-го экзонов гена УМ у больных ММ выявлено пять мутаций: 4 распространенных полиморфизма гетерозиготного характера (rs7193058, rs13335818, rs28544423, rs78691203), не приводящие к замене кодируемой аминокислоты, и одна миссенс-мутация p.142R>R/Q. Частота полиморфизмов гена УМ статистически значимо не различалась в обеих группах и составила 36% у пациентов с КН и 30% без КН (p>0,05). Две мутации (p.142R>R/Q и rs78691203) встречались только у больных с П.Н. Сочетание 2 или 3 полиморфизмов наблюдалось у 4 (29%) больных с КН и у 1 (10%) пациента в группе сравнения. В участке гена, кодирующем связующий с ЛЦ участок УМ — (D8C), выявлены 2 мутации rs13335818 и rs78691203, которые встречались как у больных КН (у 4), так и в группе сравнения (в 1 случае). Таблица 1. Количество моноклональных ЛЦ в сыворотке и в моче у больных ММ с КН и без поражения почек Таблица 2. Мутации 4-го и 5-го экзонов гена УМ у больных ММ с КН и без поражения почек Обсуждение Полиморфизмы гена УМ выявлены у 30% больных М.М. Частота минорного аллеля (MAF — minor allel frequency) полиморфизма rs7193058 в общей популяции составляет 0,419 (т.е. 419 раз на 1000 геномов), у больных ММ — 0,125. MAF rs13335818 составил 0,085 у больных ММ, в общей популяции MAF — 0,326. MAF rs28544423 — 0,105 у пациентов с ММ, в общей популяции MAF rs28544423 — 0,329. Обнаружен лишь один редкий полиморфизм rs78691203, который в общей популяции встречается с частотой 0,0198. Данных о частоте миссенс-мутации p.142R>R/Q в литературе нет [31]. Таким образом, частота выявленных полиморфизмов гена УМ у больных ММ оказалась существенно ниже, чем в общей популяции. Не исключено, что подобное несоответствие обусловлено малой выборкой пациентов. Различий по частоте мутаций в зависимости от поражения почек не обнаружено. Отсутствие существенных различий в структуре 4-го и 5-го экзонов гена УМ, в том числе в участке, кодирующем D8C, позволяет сделать вывод, что первичная структура УМ у больных КН не имеет характерных особенностей. Соответственно процесс взаимодействия моноклональных ЛЦ с УМ определяется другими факторами, например свойствами самих ЛЦ или количеством секретируемого УМ. В крупном исследовании, выполненном на выборке из 10 884 человек, выявлены полиморфизмы, влияющие на количество секретируемого УМ: rs12917707 (ген UMOD), rs12446492 (соседний ген PDILT), rs4533720 (соседний ген MARCH), rs6988636 (соседний ген FAM83). Обращает внимание, что 3 из 4 полиморфизмов локализованы вне гена У.М. Обнаружена сильная прямая корреляция между наличием этих полиморфизмов и повышением содержания УМ в моче, а при rs12917707 — с ПН [26]. Не исключено, что дальнейший анализ генома человека и изучение биологии УМ позволит выявить новые звенья в патогенезе поражения почек, в том числе при КН. Заключение У больных ММ не найдено статистически значимых различий по частоте и характеру полиморфизмов 4-го и 5-го экзонов гена УМ, в том числе в участке, кодирующем D8C, при КН и без поражения почек. Обнаружена миссенс-мутация p.142R>R/Q в гене УМ, которая ранее не была описана. Авторы заявляют об отсутствии конфликта интересов.
×

References

  1. Montseny JJ, Kleinknecht D, Meyrier A, Vanhille P, Simon P, Pruna A, Eladari D. Long-term outcome according to renal histological lesions in 118 patients with monoclonal gammopathies. Nephrol Dial Transplant. 1998;13(6):1438-1445. https://doi.org/10.1093/ndt/13.6.1438
  2. Nasr SH, Valeri AM, Sethi S, Fidler ME, Cornell LD, Gertz MA, Lacy M, Dispenzieri A, Rajkumar SV, Kyle RA, Leung N C. Clinicopathologic correlations in multiple myeloma: a case series of 190 patients with kidney biopsies. Am J Kidney Dis. 2012; 59(6):786-794. https://doi.org/10.1053/j.ajkd.2011.12.028
  3. Рехтина И.Г., Менделеева Л.П., Бирюкова Л.С. Диализзависимая почечная недостаточность у больных множественной миеломой: факторы обратимости. Терапевтический архив. 2015; 7:72-76. https://doi.org/10.17116/terarkh201587772-76
  4. Huang ZQ, Sanders PW. Localization of a Single Binding Site for Immunoglobulin Light Chains on Human Tamm-Horsfall Glycoprotein. J Clin Invest. 1997;99:732-736. https://doi.org/10.1172/jci119218
  5. Ying W-Z, Sanders PW. Mapping the Binding Domain of Immunoglobulin Light Chains for Tamm-Horsfall Protein. American Journal of Pathology. 2001;158:1859-1866. https://doi.org/10.1172/jci119218
  6. Ying W-Z, Allen CE., Curtis LM, Aaron KJ, Sanders PW. Mechanism and prevention of acute kidney injury from cast nephropathy in a rodent model. J Clin Invest. 2012;122(5):1777-1785. https://doi.org/10.1172/JCI46490
  7. Rajkumar SV, Dimopoulos MA, Palumbo A, Blade J, Merlini G, Mateos MV M., Kumar S., Hillengass J, Kastritis E, Richardson P, Landgren O, Paiva B, Dispenzieri A, Weiss B, LeLeu X, Zweegman S, Lonial S, Rosinol L, Zamagni E, Jagannath S, Sezer O, Kristinsson S, Caers J, Usmani S, Lahuerta J, Johnsen H, Beksac M, Cavo M, Goldschmidt H, Terpos E, Kyle R, Anderson K, Durie B, Miguel J. International Myeloma Working Group updated criteria for the diagnosis of multiple myeloma. The Lancet Oncology. 2014;15(12):538-548. https://doi.org/10.1016/S1470-2045(14)70442-5
  8. Drayson M, Begum G, Basu S, Makkuni S, Dunn J, Barth N, Child AJ. Effects of paraprotein heavy and light chain types and free light chain load on survival in myeloma: an analysis of patients receiving conventional-dose chemotherapy in Medical Research Council UK multiple myeloma trials. Blood. 2006;108(6):2013-2019. https://doi.org/10.1182/blood-2006-03-008953
  9. Solomon A, Weiss DT, Kattine AA. Nephrotoxic potential of Bence Jones proteins. N Engl J Med. 1991;324:1845-1851. https://doi.org/10.1056/nejm199106273242603
  10. Herrera GA. Renal manifestations of plasma cell dyscrasias. An appraisal from the patients’ bedside to the research laboratory. Ann Diagn Pathol. 2000;4:174-200. https://doi.org/10.1016/s1092-9134(00)90042-x
  11. Korbet SM, Schwartz MM. Multiple myeloma. J Am Soc Nephrol. 2006;17(9):2533-2545. https://doi.org/10.1681/asn.2006020139
  12. Sikkink LA, Ramirez-Alvarado M. Biochemical and aggregation analysis of Bence Jones proteins from different light chain diseases. Amyloid. 2008;15(1):29-39. https://doi.org/10.1080/13506120701815324
  13. Wall JS, Gupta V, Wilkerson M, Schell M, Loris R, Adams P, Solomon A, Stevens F, Dealwis C. Structural basis of light chain amyloidogenicity: comparison of the thermodynamic properties, fibrillogenic potential and tertiary structural features of four Vlambda6 proteins. J Mol Recognit. 2004;17(4):323-331. https://doi.org/10.1002/jmr.681
  14. Dealwis C, Wall J. Towards understanding the structure-function relationship of human amyloid disease. Curr Drug Targets. 2004; 5:159-171. https://doi.org/10.2174/1389450043490550
  15. Kaplan B, Ramirez-Alvarado M, Sikkink L, Golderman S, Dispenzieri A, Livneh A, Gallo G. Free light chains in plasma of patients with light chain amyloidosis and non-amyloid light chain deposition disease. High proportion and heterogeneity of disulfide-linked monoclonal free light chains as pathogenic features of amyloid disease. Br J Haematol. 2009;144:705-715. https://doi.org/10.1111/j.1365-2141.2008.07522.x
  16. Denoroy L, Deret S, Aucouturier P. Overpresentation of V kappa IV subgroup in light chain deposition disease. Immunol Lett. 1994;42:63-66. https://doi.org/10.1016/0165-2478(94)90036-1
  17. Khamlichi AA, Aucouturier P, Silvain C, Bauwens M, Touchard G, Preud’homme J.-L, Nau F, Cogne M. Primary structure of a monoclonal κ chain in myeloma with light chain deposition disease. Clinical & Experimental Immunology. 2008; 87(1):122-126. https://doi.org/10.1111/j.1365-2249.1992.tb06424.x
  18. Abraham RS, Geyer SM, Price-Troska TL, Allmer C, Kyle RA, Gertz MA, Fonseca R. Immunoglobulin light chain variable (V) region genes influence clinical presentation and outcome in light chain-associated amyloidosis (AL). Blood. 2003;101:3801-3808. https://doi.org/10.1182/blood-2002-09-2707
  19. Gu M, Wilton R, Stevens FJ. Diversity and diversification of light chains in myeloma: the specter of amyloidogenesis by proxy. Contrib Nephrol. 2007;153:156-181. https://doi.org/10.1159/000096766
  20. Poshusta TL, Sikkink LA, Leung N, Clark RJ, Dispenzieri A, Ramirez-Alvarado M. Mutations in specific structural regions of immunoglobulin light chains are associated with free light chain levels in patients with Al amyloidosis. PLoS ONE. 2009;4(4):e5169. https://doi.org/10.1371/journal.pone.0005169
  21. Горчакова С.В., Рехтина И.Г., Никитин Е.А., Каменский П.А., Судариков А.Б., Бирюкова Л.С. Первичная структура вариабельного региона легких цепей в патогенезе миеломной нефропатии. Гематология и трансфузиология. 2009;6:28-33.
  22. Serafini-Cessi F, Malagolini N, Cavallone D. Tamm-Horsfall glycoprotein: Biology and clinical relevance. Am J Kidney Dis. 2003;42:658-676. https://doi.org/10.1016/s0272-6386(03)00829-1
  23. Hart TC, Gorry MC, Hart PS, Woodard AS, Shihabi Z, Sandhu J, Shirts B, Xu L, Zhu H, Barmada MM, Bleyer AJ. Mutations of the UMOD gene are responsible for medullary cystic kidney disease 2 and familial juvenile hyperuricaemic nephropathy. J Med Genet. 2002;39:882-892. https://doi.org/10.1136/jmg.39.12.882
  24. Rampoldi L, Caridi G, Santon D, Boaretto F, Bernascone I, Lamorte G, Tardanico R, Dagnino M, Colussi G, Scolari F, Ghiggeri GM, Amoroso A, Casari G. Allelism of MCKD, FJHN and GCKD caused by impairment of uromodulin export dynamics. Hum Mol Genet. 2003;12:3369-3384. https://doi.org/10.1093/hmg/ddg353
  25. Dahan K, Devuyst O, Smaers M, Vertommen D, Loute G, Poux JM, Viron B, Jacquot C, Gagnadoux MF, Chauveau D, Büchler M, Cochat P, Cosyns JP, Mougenot B, Rider MH, Antignac C, Verellen-Dumoulin C, Pirson Y. A cluster of mutations in the UMOD gene causes familial juvenile hyperuricemic nephropathy with abnormal expression of uromodulin. J Am Soc Nephrol. 2003;14:2883-2893. https://doi.org/10.1097/01.asn.0000092147.83480.b5
  26. Olden M, Corre T, Hayward C, Toniolo D, Ulivi S, Gasparini P, Pistis G, Hwang SJ, Bergmann S, Campbell H, Cocca M, Gandin I, Girotto G, Glaudemans B, Hastie ND, Loffing J, Polasek O, Rampoldi L, Rudan I, Sala C, Traglia M, Vollenweider P, Vuckovic D, Youhanna S, Weber J, Wright AF, Kutalik Z, Bochud M, Fox CS, Devuyst O. Common variants in UMOD associate with urinary uromodulin levels: a meta-analysis. J Am Soc Nephrol. 2014;25(8):1869-1882. https://doi.org/10.1681/ASN.2013070781
  27. Rampoldi L, Scolari F, Amoroso A, Ghiggeri G, Devuyst O. The rediscovery of uromodulin (Tamm—Horsfall protein): from tubulointerstitial nephropathy to chronic kidney disease. Kidney Int. 2011;80:338-347. https://doi.org/10.1038/ki.2011
  28. Moskowitz JL, Piret SE, Lhotta K, Kitzler TM, Tashman AP, Velez E, Thakker RV, Kotanko P. Association between genotype and phenotype in uromodulin-associated kidney disease. Clin J Am Soc Nephrol. 2013;8(8):1349-1357. https://doi.org/10.2215/CJN.11151012
  29. Scolari F, Izzi C, Ghiggeri . Uromodulin: from monogenic to multifactorial diseases. Nephrol Dial Transplant. 2015;30(8):1250-1256. https://doi.org/10.1093/ndt/gfu300
  30. Bollée G, Dahan K, Flamant M, Morinière V, Pawtowski A, Heidet L, Lacombe D, Devuyst O, Pirson Y, Antignac C, Knebelmann B. Phenotype and outcome in hereditary tubulointerstitial nephritis secondary to UMOD mutations. Clin J Am Soc Nephrol. 2011;6:2429-2438. https://doi.org/10.2215/CJN.01220211
  31. Köttgen A, Yang Q, Shimmin LC, Tin A, Schaeffer C, Coresh J, Liu X, Rampoldi L, Hwang SJ, Boerwinkle E, Hixson JE, Kao WH, Fox CS. Association of estimated glomerular filtration rate and urinary uromodulin concentrations with rare variants identified by UMOD gene region sequencing. PLoS One. 2012; 7(5):e38311. https://doi.org/10.1371/journal.pone.0038311

Statistics

Views

Abstract: 312

PDF (Russian): 96

Dimensions

Article Metrics

Metrics Loading ...

PlumX

Refbacks

  • There are currently no refbacks.

Copyright (c) 2017 Rekhtina I.G., Mendeleeva L.P., Biderman B.V., Solovyev M.V., Sudarikov A.B.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.
 

Address of the Editorial Office:

  • Novij Zykovskij proezd, 3, 40, Moscow, 125167

Correspondence address:

  • Novoslobodskaya str 31c4., Moscow, 127005, Russian Federation

Managing Editor:

 

© 2018-2021 "Consilium Medicum" Publishing house


This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies